Establishment of heterozygous model of mouse embryonic stem cells with osteoprotegerin gene deletion
[Keywords:] Gene knockout; Embryonic stem cells; Bone protective agent; Osteoporosis
Establish OPG gene knockout heterozygote model? External ES cells
Qiao Jian? Oh, and? Nv, Ning Guang and others, the ninth person? The First Affiliated Hospital of Shanghai Jiaotong University, Shanghai 200232.
[Abstract] Objective To obtain homologous recombinant embryonic stem cells with OPG gene knocked out. Methods After two homologous arms were obtained by PCR, a targeting vector targeting OPG exon 2 and a small part of intron 2 was constructed with 3.3kb Xbal/ BamHI fragment as the short arm and 3.9kb NotI/ SalI fragment as the long arm. The linearized and purified targeting vector DNA was transfected into ES cells by electroporation, and then some of these ES cell lines survived G4 18 and Gancyclovir selection. Two? Drugs? Resistant clones were amplified and identified by PCR and Southern blot. The result is 124? Drugs? Resistant clones were harvested, and one of them was confirmed as positive. Conclusion The results of this experiment lay a foundation for further establishing OPG knockout mouse model and further studying OPG in vivo.
[Keywords:] knockout; ES cells; Osteoprotegerin; Osteoporosis
Osteoporosis is a systemic disease characterized by decreased bone mass and destruction of bone microstructure, which leads to increased bone fragility and prone to fracture, and is also a common disease affecting human health. How to establish a specific animal model is a hot topic in related fields. Osteoprotegerin (OPG) is a secreted glycoprotein [1] discovered in recent years, which has the activity of inhibiting the differentiation and absorption of osteoclasts and belongs to the tumor necrosis factor receptor (TNFR) superfamily. Studies have shown that OPG plays an important role in the pathogenesis, prevention and treatment of osteoporosis, rheumatoid arthritis, Paget's disease and malignant bone tissue diseases (osteosarcoma, giant cell tumor, metastatic cancer). In this study, most of exon 2 and intron 2 of mouse OPG gene were designed and constructed by molecular cloning, and OPG gene in mouse ES cells was eliminated by gene targeting technology, which laid a foundation for further preparation of OPG gene knockout mouse model by microinjection.
1 materials and methods
1. 1 experimental materials vector plasmid pbluescript Ⅰ (+/-) and XpPNT plasmid were provided by Shanghai Southern Model Biology Center, and PCR product cloning vector pGEM? Teasy is a product of Promega company. Various restriction endonucleases, T4 DNA ligase, random primer DNA labeling kit, various Taq enzymes, PCR related reagents and RT? PCR kits were purchased from Takara and NEB companies. DNAmarker( 100bp ladder, 1kb ladder, Lamda-HindIII fragment) was purchased from NEB and Takara. Protease K was purchased from Shanghai Gong Sheng Biotechnology Service Company. Trizol was purchased from GibcoBRL and Invitrogen. Small plasmid extraction kit was purchased from Huashun Bioengineering Company and Gong Sheng. Plasmid extraction kit Rapid gel extraction kit was purchased from Qiagen Company. Hyb hybridization solution was purchased from Clontech company. Conventional chemical reagents are mainly purchased from Sigma and China Pharmaceutical Group Shanghai Chemical Reagent Company. Radioisotopes [α-32P]-dCTP and [α-32P]-dATP are products of Amersham Company. Cell culture related reagents: including DMEM liquid medium (high glucose, L? Glutamine, without sodium pyranate, ES? Cells? Qualified), non-essential amino acids, glutamine, PBS without Ca2+/Mg2+, PBS with Ca2+/Mg2+, β-mercaptoethanol (2- mercaptoethanol), fetal bovine serum (ES? Cells? Qualified), G4 18, ganciclovir (ganciclovir), dimethyl sulfoxide (DMSO), penicillin/streptomycin, trypsin (trypsin /EDTA), collagen (gelatin) GANC other reagents are all Gibco? BRL, a product of Sigma, LIF(ESGROTM) is a product of CHEMICON (Australia). Consumables such as 35 mm, 100 mm cell culture dishes, 24-well, 48-well and 96-well cell culture plates and centrifuge tubes are all Corning products. Primer synthesis and sequencing: completed by Shanghai Shen You Biotechnology Company. According to the sequence data, the primer sequence was designed by DNAstar software package. ES cell line: 13 generation mice were introduced in vitro, and CJ7 cell line (from Sv 129 mice) was preserved by the Department of Medical Genetics, School of Basic Medicine, Shanghai Second Medical University.
1.2 experimental method
Construct 1.2. 1 target vector.
1.2. 1. 1 Extract ES cells with good genomic DNA harvest status, add a proper amount of lysate and protease K, and stay overnight at 56℃; The next day, the sample was centrifuged at room temperature of 12000 rpm10 min; . Collecting supernatant, precipitating with anhydrous ethanol, precooling with ice, and washing with 70% ethanol; After air drying, appropriate amount of pure water is dissolved and stored at 4℃ for later use.
Two homologous arms were obtained by 1.2. 1.2 PCR, and the mouse OPG gene sequence was obtained in Genebank by BLAST. According to the sequence provided by NCBI GenBank, the upstream and downstream homologous arms of two pairs of primers were determined by Primerselect of DNAstar software. Upstream primer of upstream homologous arm: CGTAGGATCCGTACCTCAGCCTCTGAAGAT (corresponding to OPG gene14842-14861BP); Downstream primer: tcggtctagacaggggctag aagagacaca (corresponding to OPG gene18152-18171BP); PCR conditions: 95℃, 5min;; ; 94 ℃,50s; 60 ℃,50s; 72℃, 3.5 minutes. 35 cycles: 72℃, 65438 00 minutes; 4℃, forever. The upstream homologous arm length is 333 1 bp. Upstream primer of downstream homologous arm: ACCGTCGACAGCCAGACAGCAGCTAACT (corresponding to OPG gene 18580~ 18598bp) and downstream primer: GTGGCGGCCGCACAGCCAGGACTGTCAACA (corresponding to OPG gene 22478 ~ 22497bp); ); The reaction conditions of PCR were: 95℃, 5min;; ; 94 ℃,50s; 6 1.5 ℃,50s; 72℃, 4 minutes. 35 cycles: 72℃, 65438 00 minutes; 4℃, forever. The downstream homologous arm length is 39 18 bp.
1.2. 1.3 correctly clone the DNA fragment into XpPNT vector. The PCR products of two homologous arms were recovered and connected to the PCR product cloning vector pGEM? Detection, sequencing and identification of Escherichia coli after transformation and amplification. The downstream homologous arm was introduced into vector x by NotI/SalI by conventional method. PpnT, and then insert the upstream homologous arm into x? The PpnT vector was identified by restriction endonuclease and sequence determination showed that the sequence was correct. The targeting vector was named 5-3opg-XpPNT, and was linearized with NotI restriction endonuclease, recovered and stored at -20℃ for later use.
Gene targeting of 1.2.2 ES cells
Electroporation gene transfer of 1.2.2. 1 ES cells Take 0.8 ml of ES single cell suspension with a density of about 1.2× 107/ml, and add PBS0. 1 ml containing Ca2+ and Mg2+ (containing about 30 μg). XpPNT), mixed and transferred to a sterile electroporation cup. At room temperature, the cells were resuspended in ES medium after single pulse electric shock with electric parameters of 240 V and 500 μF, and the cell suspension was evenly inoculated into two 35 mm collagenized plates. After resuscitation in non-selective medium for 24 hours, drugs were screened.
1.2.2.2 drug screening drug selection for resistant cells began 24 hours after electroporation gene transfer. Among them, 1 30mm plate was cultured in selective medium containing selective drugs G4 18 (final concentration 400 g/ml) and ganciclovir (final concentration 2 mmol/L), while other 1 plates were still cultured in non-selective medium as control. After 7~8 days of screening, the ES cell clones grow into visible cell colonies, which can be picked. 14 days * * * screened 124 drug-resistant cell clones.